EST details — SGN-E553635
| Search information |
| Request: 553635 | Match: SGN-E553635 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C332291 | Clone name: cTSC-1-L4 |
| ||
| Library Name: cTSC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: seed
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E553635 | Length: 176 bp (1420 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E553635 [] (trimmed)
GGCGGCGGACATGGCTGGTGGCGGCGGCTATGGAGGTGGTGGTGGTGGCAGCGGAGGTGGTCATGGTGGGGGAGGTGCCCATGATGGTTTATCTC
TTTGCAATGTCCATCATCTCGTCTGACTGATGCTCACATTTGGAATTCTCCGAGTTTTATCTTATGAGATCATTTGGCATT
TTTGCAATGTCCATCATCTCGTCTGACTGATGCTCACATTTGGAATTCTCCGAGTTTTATCTTATGAGATCATTTGGCATT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E553635] | SGN-U602954 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T356062 [Download][View] | Facility Assigned ID: ctsc1l4 |
| Submitter: Koni | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.915 | Expected Error Rate: 0.0279 | Quality Trim Threshold: 14.5 |


