EST details — SGN-E557717

Search information 
Request: 557717Match: SGN-E557717
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C334801Clone name: 16560
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E557717Length: 366 bp (992 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E557717 [] (trimmed) GTGAAAGATGTTCCCCCCCACGACGTTGTCAGGCTAATGCCGTCATCTCAAGCGCTCGGGAAAGATGGAGCTTCCTGAATGGACTGATATAGTCA
AGACTGGTAAGCTAAAGGAGCTTGCCCCATATGATGCTGATTGGTACTACATCAGAGCTGCTTCTATGGCGAGGGAAGATCTATTTGAGAGGAGG
TATTGGCGTCGGTGGGTTCCGAAGAATTCTATGGTGGTAACCAGAGGAATGGAAGCCGTTCACGTCATTTTTGCAAAAAGCAGTGGTTCAGTTGC
CGCCACATTCTTCAACAAATTTGCAGAACCATGAACATCAATTGATTTTGAGCCCTAAGGGTGGAAAGGGAGGATCACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E557717] SGN-U287220 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T358672 [Download][View] Facility Assigned ID: bf_swstxxxx_0007f10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0335 Quality Trim Threshold: 14.5