Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E557774

Search information 
Request: 557774Match: SGN-E557774
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C334866Clone name: 16625
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E557774Length: 321 bp (475 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E557774 [] (trimmed) TACAAAGAATGGATGGTGTTATTGACTTTGAATCAGATGATTCTGATTTGTTGAATTGATCCTACTGGAAATATGGAAGTACAATGAAATTCTTG
GTAAAGGGGCTTCAGACGTATATAAGCTTGATGAGTATGAGTGAGTACATGGAATCAGTGAAGCTTTATGACTTTATGCAAAGTCCTGAAATCTT
GAAGCTGTATTGTGAAATTCATCTGCTTAAGACATTGAAGCACAAAAATATCATGAAGTTTTATACTTCTTGGGTTGATGTTGCTAATAGGAACA
TTAACTTTGTTACAGAGATGTTCACTTCTGGAACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E557774] SGN-U289555 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T358738 [Download][View] Facility Assigned ID: bf_swstxxxx_0008d04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0187 Quality Trim Threshold: 20.5