Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E563621

Search information 
Request: 563621Match: SGN-E563621
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C340192Clone name: 2062
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563621Length: 378 bp (1154 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563621 [] (trimmed) AGTATGGTTCTTACAATTTTTCTGTGCTTCTTCGATTTACAGAGAAGATGCCGGGGGGATGATGACCGGTATGGTGGCACGCGTCTATATGGTTG
GACATTTGTCATCCCCGAACGCGGATCTCGAGACTTGGAGGATGTCTTTAGCACGATATGGGAGAGTACGTGATGTGGATATGAAGCGTGACTAT
GCTTTTGGGGAGTTTAGTGATCCTCGAGATGCCGATGATGCAAGGATATGGCCTAAATGGGCGAGATGTTGATGGAAGCCGCGTTATCGTGGAGT
TCGCCAACAGGGGGTGCCTCGTGGTCCACGTGGATCTCGAGAGTATTGGTGGCAGAGGTCCTCCTCCACGTACAAGGTCGTTGCTTTAATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563621] SGN-U288668 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T364499 [Download][View] Facility Assigned ID: TBSK01669Fd01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0315 Quality Trim Threshold: 14.5