Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E573358

Search information 
Request: 573358Match: SGN-E573358
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C350684Clone name: 32656
nocartOrdering Not Available
Library Name: IVROOTOrganism: Solanum tuberosum

Tissue: Root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E573358Length: 298 bp (399 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E573358 [] (trimmed) CCTCGTGCCGCAAGAATCGAAATCTCAAGTCTGCTAGGGAGCTTATGAAGCTGCAAAAGCCTCCAGAACCTGATTTCAGTGAAGATACTGAGTGA
ATTTTGTATGCTTTTTTGCTTAGACTTGTTGATCTTTGCAAAAAGCTTGATGTATAATTCATGTTTATTAGTCTTATTGCTTCATATTTGTGTAA
GAGTTTTAACTTCAATACACTGATACTACTGATACTGATTGTGTAAATAAATATTTACATTTATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E573358] SGN-U288126 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T374455 [Download][View] Facility Assigned ID: bf_ivrootxx_0021a03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.889 Expected Error Rate: 0.0004 Quality Trim Threshold: 14.5