Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E577841

Search information 
Request: 577841Match: SGN-E577841
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C354946Clone name: LE08AC06
nocartOrdering Not Available
Library Name: LE08Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 8 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E577841Length: 460 bp (790 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E577841 [] (trimmed) CGGCTACAACCGCCGCTAAAAGTATTATAATTTGTCGCTAAAGGTCTAATTATGGGCGACTTTAAATGTCGCTCAAAGGTTGTTTTGGTGGAGAC
TATAACTGTTTCTATAACTCTAAAAGTTGTTGCTAAAAGGTGTATACTAGTGACGACTTTAATTGCCGCTGAAACTTTTACATGTTGTGGCAAAA
GGTGTTATTAGTGGCGACTTTAAACGGCGCTAGAACTCTTAAAAGTTGTCGCAAAACGTCCACATACCAGTCCATAATCTTAGGTTATAATGACA
CATACAAACATCCACTTACAAGTAAGTCGAATCCATAGCTCGAAACCAAAAACAAAGGATTATCATGGGAAAAAAATAATGCCTACAGTAAAGAA
TAAATACTAGTAGTATAATGGTGAAATCTTAGATACATGACAGTGTGATATTCATGCGATAATTACAGACAACTCACACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E577841] SGN-U598070 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T378937 [Download][View] Facility Assigned ID: LE08AC06
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5