Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E578093

Search information 
Request: 578093Match: SGN-E578093
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C355198Clone name: LE08EA04
nocartOrdering Not Available
Library Name: LE08Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: 8 days post anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E578093Length: 229 bp (802 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E578093 [] (trimmed) ATAATGTATCATTGTCTCTTCACGATGCACTCCCTTTCTGTATTACTAAATTAATTACAAGTTTTGATACTGAAGGGCAAACAAAAAAAGGTCAC
TAATTAATATCTAATAAATTAATTAAATTCCATAATGAATTGGATTTTTTTCATTTTGTCAGGTCATGGTAGCTTCGAATCAAAGTATTTATATA
TTTAAATATCTATAAATAAATCATCTTTTACAAACCCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E578093] SGN-U600369 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T379011 [Download][View] Facility Assigned ID: LE08EA04
Submitter: Virginie Garcia Sequencing Facility: PRI
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.859 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5