EST details — SGN-E580872
| Search information |
| Request: 580872 | Match: SGN-E580872 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C358744 | Clone name: 6115 |
| ||
| Library Name: ACDA | Organism: Solanum tuberosum |
Tissue: Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E580872 | Length: 189 bp (1215 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E580872 [] (trimmed)
GCCCAAACTTTCTCTCCCAATTTTCTCATTCTCTCTATAAACTTCTCTCACTTTCTGCAAATCTACTTTATTTTAAGCTTATAAATCATGTCTTG
CTACAAGGGAAAAGTATGCTGATGAGCTTATCAAGAATGCTGCGTATATTGGCACCCCTGGGAAATGGGTATCCTTGGCTGCTGATGAATCCAC
CTACAAGGGAAAAGTATGCTGATGAGCTTATCAAGAATGCTGCGTATATTGGCACCCCTGGGAAATGGGTATCCTTGGCTGCTGATGAATCCAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E580872] | SGN-U287269 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T381748 [Download][View] | Facility Assigned ID: ACDA00864H12.T3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.915 | Expected Error Rate: 0.0346 | Quality Trim Threshold: 14.5 |
Working
