EST details — SGN-E584240
Search information |
Request: 584240 | Match: SGN-E584240 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C357199 | Clone name: 10061 |
| ||
Library Name: ACDA | Organism: Solanum tuberosum |
Tissue: Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E584240 | Length: 176 bp (450 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E584240 [] (trimmed)
TAGCACGTGAATATTTTCATCAACCCTATGAGGAGAAAATCGAGATCAAACTCTCATGCAGAAACTGGATACAGAGGATATCAAAGAATTGGAGA
GAATATAACCAAAGGCAAACCTGACATACCATGAAGCTATTGATTGCTATCGGAGGCAGTGAAACATGGCGATGTATGGAG
GAATATAACCAAAGGCAAACCTGACATACCATGAAGCTATTGATTGCTATCGGAGGCAGTGAAACATGGCGATGTATGGAG
Unigenes |
Current Unigene builds | |||||
[SGN-E584240] | SGN-U295485 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T385116 [Download][View] | Facility Assigned ID: ACDA04265D05.T3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.954 | Expected Error Rate: 0.0079 | Quality Trim Threshold: 20.5 |