EST details — SGN-E588648
| Search information |
| Request: 588648 | Match: SGN-E588648 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C365661 | Clone name: 42206 |
| ||
| Library Name: CSCH | Organism: Solanum tuberosum |
Tissue: Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E588648 | Length: 239 bp (817 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E588648 [] (trimmed)
GCGGAAGTGGACCTCCTCCTCCCTGGGACAGCAAGATTCCAGATTCAGCTTGGGGTGAATATGCCAGCGAGGGCGGAGTATATACCAAAAGAAGG
TCAAACACAGGTGTTCCACGAAGTATATGACGTTGTGTTATACTTGGGGATAATTGACATATTGCAAGAATACAACATGAGCAAGAAGTTAGAAC
ATGCATACAAATCGATTCAGTTTGATTCCGTTTCCATTTCTGCTGTTGA
TCAAACACAGGTGTTCCACGAAGTATATGACGTTGTGTTATACTTGGGGATAATTGACATATTGCAAGAATACAACATGAGCAAGAAGTTAGAAC
ATGCATACAAATCGATTCAGTTTGATTCCGTTTCCATTTCTGCTGTTGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E588648] | SGN-U294603 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T389524 [Download][View] | Facility Assigned ID: bf_cschxxxx_0013f04.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.982 | Expected Error Rate: 0.0087 | Quality Trim Threshold: 20.5 |
Working
