Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E597841

Search information 
Request: 597841Match: SGN-E597841
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C374854Clone name: 67714
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E597841Length: 289 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E597841 [] (trimmed) TAATTTTTTTTTTTTTTTTTTTAAACTGAAAGGATGTTCATATAGTAGCATTGCAATGAAAATACAACAGGAGTGCATACCAACAAAACACATCT
TATTGCACATTCAACTACTACGAGCACCAAACATCCTATTCAACCAAGATATGATTTCGTGCAGTAAAATTCTAGAAATACAAATTTCATACTTA
TCTACAGCGGCCTATTGATAATTTGGATCTCTTCCAGGCATGTTTTGATTCTGAAGAGGGTTTCCACCAGACGTATTCGGAGCATAGTTCTGACT
TGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E597841] SGN-U298065 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T398717 [Download][View] Facility Assigned ID: bf_cswbxxxx_0058g01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5