EST details — SGN-E605302

Search information 
Request: 605302Match: SGN-E605302
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C382135Clone name: 21219
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E605302Length: 330 bp (965 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E605302 [] (trimmed) CGAGGGAAGTTATCGATCACCTTAAAAAAGAGTATCCTTACCCTGCTATAGAGAGGCAAGATCATGATTCAGTAATCCCCTCAGAGATTTCATCA
AAGAAATTGAGAGCTCTGGGATTTTCTTTCAAGTATGAAATCAATGATATCGTACGAGATACAATTAGTAGTTGTATACATCATGGCTTCTTTGC
CTCTATTCAAAAGTAAGAATTCCAATTACATGTAGGTAAACGAATACCTTTCTCAGTTGGAAACGGATTTTTCAACTTTTATTGTTCTCTGTAAA
AATCCCTTTGTGAGTTGGAAACGGATTTTTCAACTTGTTCATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E605302] SGN-U291429 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T405998 [Download][View] Facility Assigned ID: bf_tubsxxxx_0003h08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0057 Quality Trim Threshold: 12.5