Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E607759

Search information 
Request: 607759Match: SGN-E607759
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C384592Clone name: 23732
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E607759Length: 353 bp (640 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E607759 [] (trimmed) GAAGTTCTTTGCCAGGACCAGTATGGATGTACCCCATTTCTTATATAGCTTTTCATACTTACTCTATCCAGGNGCTCTTGGAGAACGAGTACATC
GAGACCTCTTTTGCAGTTGGTCAGGTGAGGACCATATCTGGTAATCAGGCTTTGCAAAATGTATATGACATATCTGCTGATAGCAACTCTAAGTG
GAAAAATTTGTTAGTATTGTTTCTTATGGCTGTTGCATACAGAGTTCTTGTTTTTGTTTTGCTCAAGTTTTATGTCAGGAAAAACCTCTTTGTAC
CCAAACTATTTCTCTGTAACCAAAATACAAGGAATTCAAGATAAATGCTATACTCCTAGCAACTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E607759] SGN-U292169 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T408455 [Download][View] Facility Assigned ID: bf_tubsxxxx_0031f05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0061 Quality Trim Threshold: 12.5