EST details — SGN-E608174

Search information 
Request: 608174Match: SGN-E608174
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C385007Clone name: 24155
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E608174Length: 297 bp (610 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E608174 [] (trimmed) AAATTCTCAAAAAAAAAACAGTGTACTTGTACAACATAAAAAATGGTGAAAACAAGAGTTAGCTTTATGAGGTTTCTTGTCTTAGCAATGGCTGT
AGTCTTTCTTCCATCCCAAATTCAAGCATTAATGCCATACACACGCCCCTTTTGGGACATAGCATTTCCAACAGAAGATCCTTTCAGAATTCTTG
TTTCAAACCCCATTGACTATCCCAAAAGGGGTCGAATCAATCGCCTTAACTCGCATCAGATTGGAAGGAAACAGCAACAGAGCATGTAATTACAC
TTGACATTCCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E608174] SGN-U296866 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T408870 [Download][View] Facility Assigned ID: bf_tubsxxxx_0036a08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0089 Quality Trim Threshold: 20.5