EST details — SGN-E612084

Search information 
Request: 612084Match: SGN-E612084
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C389097Clone name: 61843
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E612084Length: 323 bp (420 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E612084 [] (trimmed) CTTTCCTGATCCACAAAAATTTGATCCTTCAAGATTTGAGAATGCGCCAAAACCCAATACATTTATGCCATTTGGCAGTGGAGTGCATGCTTGTC
CAGGGAATGAACTTGCCAAGCTGGAAATTCTAATTATGACACATCATCTAGTCACTAAATTCAGGTGGGAAGTGGTAGGATCTGGTAGTGGGATT
CAATATGGACCATTCCCAGTCCCATTGGGTGGACTAGAAGCAAGATTTTGGAAGGAATCAACCTAATGGCTCTTCTGATTTGCATATCTCAAATG
ATTTCATCGATCTTATCCAAGATTGTTACTCATCATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E612084] SGN-U295819 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T412534 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0014e03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5