EST details — SGN-E612135
Search information |
Request: 612135 | Match: SGN-E612135 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C389148 | Clone name: 61894 |
| ||
Library Name: MXLF | Organism: Solanum tuberosum |
Tissue: Leaves
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E612135 | Length: 179 bp (902 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E612135 [] (trimmed)
GGAAGTAATTTTCCTTGGTCTTGACACAACTGAATAGCTGAGATTTTGAGCATCAATTGCAAAACTGTTAGCCATTGCGGCATTTCTGTGAGAAT
TAATGGGTGGCAATTGCAGAGCTGAAGCTCGAACACAAACAGACTGTATCATTTTTACCCAACAAAAACTCGATTTCAAGCTAG
TAATGGGTGGCAATTGCAGAGCTGAAGCTCGAACACAAACAGACTGTATCATTTTTACCCAACAAAAACTCGATTTCAAGCTAG
Unigenes |
Current Unigene builds | |||||
[SGN-E612135] | SGN-U294019 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T412352 [Download][View] | Facility Assigned ID: bf_mxlfxxxx_0015a07.t3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.926 | Expected Error Rate: 0.0033 | Quality Trim Threshold: 12.5 |