EST details — SGN-E613440
| Search information |
| Request: 613440 | Match: SGN-E613440 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C390453 | Clone name: 63214 |
| ||
| Library Name: MXLF | Organism: Solanum tuberosum |
Tissue: Leaves
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E613440 | Length: 175 bp (577 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E613440 [] (trimmed)
AAGTAACAGAGAACCCACGAAACCACAAACCTCTTATCGCCTTCTTCCTTCCTCCGATCACCGATCATCGATCATCAAACAAACAAGATCCGCCC
ATCTGTTGTTCTGATTATGCTGGATACATGGTGAAATTTGAAGGCAAAGTTGTGTATTCTTCGCTTGCTAATTTGGAAAA
ATCTGTTGTTCTGATTATGCTGGATACATGGTGAAATTTGAAGGCAAAGTTGTGTATTCTTCGCTTGCTAATTTGGAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E613440] | SGN-U289111 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T411849 [Download][View] | Facility Assigned ID: bf_mxlfxxxx_0029h04.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.955 | Expected Error Rate: 0.0009 | Quality Trim Threshold: 20.5 |
Working
