EST details — SGN-E614953

Search information 
Request: 614953Match: SGN-E614953
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C391966Clone name: 64746
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E614953Length: 346 bp (945 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E614953 [] (trimmed) CTCGAGTTTTTTTTTTTTTTTTTTACCATATAAAATAAGTGTACATAAATTAACCAGAAATTACAACTAATTAAAGGTTCGTTTAAACTCAAGTT
TTTCTTCCCATTTCATATTTTAGTCTTTTTATAATTTTGAACATAACTTAATATATTTTCCACATAATTATCTTGCCTTCTTTTGTCACAAAAGA
TATTTTTCGCCTCTTTAATCTTTTCTCGATAAATTTCACCCTGTTTTTCAACAAGTACTAGACTCACTGACTCAGCCACCGAGTCACGAGTGAAC
GACCCATCACGATCATCTCTTGGAATCAAATACGCCATCTTCTTCTCCTCCAGTAGTGTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E614953] SGN-U291575 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T414776 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0048a10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5