EST details — SGN-E617809

Search information 
Request: 617809Match: SGN-E617809
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C394822Clone name: 68480
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E617809Length: 208 bp (1417 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E617809 [] (trimmed) TATTTATTCGCCGTGGACGAGGTTGTCGGTGCCGTTGTTTTTTCTCCGGGATATGGTCAGCATCATGAACGTTGATAGAAAAATTAGTAGTGAAG
ATGAGTATATTAGGAGACATCATAGACATGATGTTAGAGATAATCAGTGTAGTTCATCACTTGTAAAGCATATTAAAGCTCCTGTTCATCTTGTN
TGGGTCATTAGTGAGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E617809] SGN-U293158 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T418685 [Download][View] Facility Assigned ID: bf_mxflxxxx_0005a04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0253 Quality Trim Threshold: 14.5