EST details — SGN-E617809
| Search information |
| Request: 617809 | Match: SGN-E617809 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C394822 | Clone name: 68480 |
| ||
| Library Name: MXFL | Organism: Solanum tuberosum |
Tissue: Floral buds
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E617809 | Length: 208 bp (1417 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E617809 [] (trimmed)
TATTTATTCGCCGTGGACGAGGTTGTCGGTGCCGTTGTTTTTTCTCCGGGATATGGTCAGCATCATGAACGTTGATAGAAAAATTAGTAGTGAAG
ATGAGTATATTAGGAGACATCATAGACATGATGTTAGAGATAATCAGTGTAGTTCATCACTTGTAAAGCATATTAAAGCTCCTGTTCATCTTGTN
TGGGTCATTAGTGAGGAG
ATGAGTATATTAGGAGACATCATAGACATGATGTTAGAGATAATCAGTGTAGTTCATCACTTGTAAAGCATATTAAAGCTCCTGTTCATCTTGTN
TGGGTCATTAGTGAGGAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E617809] | SGN-U293158 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T418685 [Download][View] | Facility Assigned ID: bf_mxflxxxx_0005a04.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.960 | Expected Error Rate: 0.0253 | Quality Trim Threshold: 14.5 |


