EST details — SGN-E625531

Search information 
Request: 625531Match: SGN-E625531
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C413914Clone name: cccp14b9
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C413914 [cccp14b9] Trace: SGN-T442220 EST: SGN-E632796 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E625531Length: 413 bp (622 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E625531 [] (trimmed) GGTTCTCGATCCTCGTGACTCGCATAGAGCCGGTAATTTTACTCCTTCCGCCAACTCCCAGGTCAACACTCAACCGCCGATCCCTCTATGGTTTC
CGCCCGTACGCTCTTCTCTTCTCCTCTGACTTGGACATTTTCACGATTGGAGTAGATCCAATAACAAGATGTTTGGGAGGGTGCCGAAAAGGAGC
GATAACACAAAGTACTATGATGTATTGGGGGTTTCCAAGAACGCCTCCCAAGATGATCTCAAGAAGGCTTATCGTAAAGCTGCCATCAAGAATCA
CCCTGATAAGGGAGGAGATCCGGAAAAGTTTAAAGAGCTATCTCAAGCCTACCACGTACTTAGTGACCCAGAGAAGCGTGAGATCTATGATCAGT
ATGGTGAGGATGCATTGAAGGAAGGAATGGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E625531] SGN-U620424 Coffea canephora Build 3 1 ESTs assembled
[SGN-E625531] SGN-U640686 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T437777 [Download][View] Facility Assigned ID: cccp14b9.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15