EST details — SGN-E635321
| Search information |
| Request: 635321 | Match: SGN-E635321 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C419932 | Clone name: cccp23o3 |
| ||
| Library Name: cccp | Organism: Coffea canephora |
Tissue: Pericarp
Development Stage: All development stages combined
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E635321 | Length: 198 bp (961 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E635321 [] (trimmed)
GGCGGAATATTCGCAAAGTAGGTGTAGTTGGCCGGCCCTGCGGGGGCATTTTGCTTCTTTCTCTTGTGGATCTCGTTTCATCCCATGTTTTAAAC
CTGTGTATGTTGAGGGATGTTTGCCTTTTAGAAGGCACCGGGTCTCTTATTAATGTACGTCACGAAATGAAATGCTATATAATTAATTGGTTTTT
GTGCTGCC
CTGTGTATGTTGAGGGATGTTTGCCTTTTAGAAGGCACCGGGTCTCTTATTAATGTACGTCACGAAATGAAATGCTATATAATTAATTGGTTTTT
GTGCTGCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E635321] | SGN-U617445 | Coffea canephora | Build 3 | 38 ESTs assembled | |
| [SGN-E635321] | SGN-U637058 | Coffee species | Build 1 | 89 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T443795 [Download][View] | Facility Assigned ID: cccp23o3.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
