EST details — SGN-E635490
Search information |
Request: 635490 | Match: SGN-E635490 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C424784 | Clone name: cccs18w10a20 |
| ||
Library Name: cccs18w | Organism: Coffea canephora |
Tissue: Edorsperm and perisperm
Development Stage: 18 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E635490 | Length: 135 bp (663 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E635490 [] (trimmed)
GGTTTAACAAGTACTATGAAGAAGAGAAACGTTATGCAACCAACATTTCTCAACTTACTTCACAGAGCGGTTATTCTTCGGGAAGCAGCGATACA
TACAGTACTCAACAAATTTCTGAAGATAATTCTAGCGGTG
TACAGTACTCAACAAATTTCTGAAGATAATTCTAGCGGTG
Unigenes |
Current Unigene builds | |||||
[SGN-E635490] | SGN-U629007 | Coffea canephora | Build 3 | 1 ESTs assembled | |
[SGN-E635490] | SGN-U646440 | Coffee species | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T448647 [Download][View] | Facility Assigned ID: cccs18w10a20.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |