EST details — SGN-E650837
| Search information |
| Request: 650837 | Match: SGN-E650837 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C450693 | Clone name: cccs30w32k9 |
| ||
| Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E650837 | Length: 104 bp (974 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E650837 [] (trimmed)
GTTCCGGGAGCCGGAGGTGATGAAACAATATGGAGTCAAGACCGATATTGAAGTTCTTGACATGCTTGACACTGCTGCCCGGCAGAAAGAGATAA
TCATCGTCT
TCATCGTCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E650837] | SGN-U618540 | Coffea canephora | Build 3 | 5 ESTs assembled | |
| [SGN-E650837] | SGN-U638410 | Coffee species | Build 1 | 26 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T474556 [Download][View] | Facility Assigned ID: cccs30w32k9.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |


