EST details — SGN-E651273

Search information 
Request: 651273Match: SGN-E651273
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C401886Clone name: cccl7o4
nocartOrdering Not Available
Library Name: ccclOrganism: Coffea canephora

Tissue: LeafB
Development Stage: Young

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E651273Length: 61 bp (1127 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E651273 [] (trimmed) CCTCAGCCACGAAACAATAAACTCTGCTCCACTCAACTCTTTCCTCTGTGTCTTGTACTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E651273] SGN-U616867 Coffea canephora Build 3 41 ESTs assembled
[SGN-E651273] SGN-U629954 Coffee species Build 1 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T425749 [Download][View] Facility Assigned ID: cccl7o4.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15