EST details — SGN-E653111
Search information |
Request: 653111 | Match: SGN-E653111 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C403175 | Clone name: cccl3h4 |
| ||
Library Name: cccl | Organism: Coffea canephora |
Tissue: LeafB
Development Stage: Young
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E653111 | Length: 162 bp (1010 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E653111 [] (trimmed)
TCTCAAGTCCAAAAATAAGGATGTTAAGATATACGGAGTCGAGCCTACCGAAAGCAATGTCTTGAGTGGCGGCAAACCAGGTCCTCATCATATCA
CTGGTAATGGGGTTGGATTCAAACCTGTTTTCCTTGACGTGGATGTAATGGAACGAGTTCTCATGGG
CTGGTAATGGGGTTGGATTCAAACCTGTTTTCCTTGACGTGGATGTAATGGAACGAGTTCTCATGGG
Unigenes |
Current Unigene builds | |||||
[SGN-E653111] | SGN-U620794 | Coffea canephora | Build 3 | 1 ESTs assembled | |
[SGN-E653111] | SGN-U641823 | Coffee species | Build 1 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T427038 [Download][View] | Facility Assigned ID: cccl3h4.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |