EST details — SGN-E653111

Search information 
Request: 653111Match: SGN-E653111
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C403175Clone name: cccl3h4
nocartOrdering Not Available
Library Name: ccclOrganism: Coffea canephora

Tissue: LeafB
Development Stage: Young

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E653111Length: 162 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E653111 [] (trimmed) TCTCAAGTCCAAAAATAAGGATGTTAAGATATACGGAGTCGAGCCTACCGAAAGCAATGTCTTGAGTGGCGGCAAACCAGGTCCTCATCATATCA
CTGGTAATGGGGTTGGATTCAAACCTGTTTTCCTTGACGTGGATGTAATGGAACGAGTTCTCATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E653111] SGN-U620794 Coffea canephora Build 3 1 ESTs assembled
[SGN-E653111] SGN-U641823 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T427038 [Download][View] Facility Assigned ID: cccl3h4.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15