EST details — SGN-E654049
| Search information |
| Request: 654049 | Match: SGN-E654049 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C403826 | Clone name: cccl7f1 |
| ||
| Library Name: cccl | Organism: Coffea canephora |
Tissue: LeafB
Development Stage: Young
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E654049 | Length: 226 bp (1059 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E654049 [] (trimmed)
GTTGCTACTTGTGTGGTTTCACTTAAAATTCTTCTCGTCTTTTCTTGTTGGAGTATCATGCCATGTGCTCCTTCCGTTGTATAATACTTGCTCTT
AATTAGACCACTGTTCTTGCTCCTTTTTCTTTTTTGTCGTTTTCTATCTGGTGGTTTGCACAACATATAGGAACAAAGACTGCTGTGCAGATCAT
AAGTCATGCACAGAAATTCTTTACAAAGTTGGAAAA
AATTAGACCACTGTTCTTGCTCCTTTTTCTTTTTTGTCGTTTTCTATCTGGTGGTTTGCACAACATATAGGAACAAAGACTGCTGTGCAGATCAT
AAGTCATGCACAGAAATTCTTTACAAAGTTGGAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E654049] | SGN-U614008 | Coffea canephora | Build 3 | 28 ESTs assembled | |
| [SGN-E654049] | SGN-U634580 | Coffee species | Build 1 | 29 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T427689 [Download][View] | Facility Assigned ID: cccl7f1.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
