EST details — SGN-E656046

Search information 
Request: 656046Match: SGN-E656046
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C404828Clone name: cccl21c13
nocartOrdering Not Available
Library Name: ccclOrganism: Coffea canephora

Tissue: LeafB
Development Stage: Young

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E656046Length: 288 bp (1032 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E656046 [] (trimmed) GGGCCATGCCGACGATTGGGACGATGTATATGGGTTTGAATTCTCCCTCCTCCCGGCACTAGACCCGGACGAAGAAAATGCCTACAAAGGTGGAA
AGATGACTGTTAAGGCCTTGCATGATGGGAAGGATATGTACTTCTTGTTGCAAGTGGATGGGAACTATATCTACTCAAAAGGAGATAATCATGGA
TGCCCATCTGTGGCACTTATGTTTCAAGTTGGTGAGAGTGCTACCTACCACAGAATGGGTGGATGTAAAGAATCACCAAATACGTGCAACAAAAC
AAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E656046] SGN-U623423 Coffea canephora Build 3 1 ESTs assembled
[SGN-E656046] SGN-U643056 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T428691 [Download][View] Facility Assigned ID: cccl21c13.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15