EST details — SGN-E663811
Search information |
Request: 663811 | Match: SGN-E663811 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C411648 | Clone name: cccl31a2 |
| ||
Library Name: cccl | Organism: Coffea canephora |
Tissue: LeafB
Development Stage: Young
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E663811 | Length: 289 bp (1103 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E663811 [] (trimmed)
CCCCTTCTTCTTCTTCTTCTTCTTCTTCTGCTGCTGCTGCTTATTCTGCGCCCCTCCTTTTCCCTGTCAAAAAATCCAGCATCCCAACAAGAAAC
TTCCCTTCATTTCTCCACTCCGCAACATCTCACATTTCCCTCGGCGTTCCCCGAGCCGCCTCCTCATCCTCCTCCCCCTCCCCCATGATAGAGAA
TGAAACCTTATAAACCCACCGTCCCCACACCTTCCTCCGCAAATCAGATGAGGCTGCGGCCTTCTCCTCCTCCTCCTCCTCTTCTGATTCTGCCG
GCTC
TTCCCTTCATTTCTCCACTCCGCAACATCTCACATTTCCCTCGGCGTTCCCCGAGCCGCCTCCTCATCCTCCTCCCCCTCCCCCATGATAGAGAA
TGAAACCTTATAAACCCACCGTCCCCACACCTTCCTCCGCAAATCAGATGAGGCTGCGGCCTTCTCCTCCTCCTCCTCCTCTTCTGATTCTGCCG
GCTC
Unigenes |
Current Unigene builds | |||||
[SGN-E663811] | SGN-U615825 | Coffea canephora | Build 3 | 2 ESTs assembled | |
[SGN-E663811] | SGN-U633951 | Coffee species | Build 1 | 8 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T435511 [Download][View] | Facility Assigned ID: cccl31a2.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |