EST details — SGN-E675081

Search information 
Request: 675081Match: SGN-E675081
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C463748Clone name: cccs46w29p2
nocartOrdering Not Available
Library Name: cccs46wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E675081Length: 216 bp (1726 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E675081 [] (trimmed) ATTGGGGGTCTTCCAAGAACGCCTCCCACTATGATGTCGGCACACGGCTTATCGTATACAGCCTGCCATCAAGAATCACCCTGATAAGGGAGGAG
ATCCTTAAAAATTTAAAGAGCTAGCTCAAGCCTACGAGGTACTTAGTGACCCAGAGAAGCGTGAGATCTATGATCAGTATGGTGAGGATGCATTG
AAGGAAGGAATGGGTGGTGGAGGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E675081] SGN-U614059 Coffea canephora Build 3 62 ESTs assembled
[SGN-E675081] SGN-U636491 Coffee species Build 1 89 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T487611 [Download][View] Facility Assigned ID: cccs46w29p2.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15