EST details — SGN-E694978
Search information |
Request: 694978 | Match: SGN-E694978 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C468144 | Clone name: LH_Ea05F08 |
| ||
Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C468144 [LH_Ea05F08] | Trace: SGN-T496737 | EST: SGN-E691138 | Direction: 5' | Facility: AGI |
Sequence |
Sequence Id: SGN-E694978 | Length: 193 bp (1113 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E694978 [] (trimmed)
TTTTTTTTTTTTTTAGAGTTCAACCAAAATATTTTATTCATTTACCGTTTAAGGGGGGGATAACGCTCCATTGCCCACATTACAACCCTTAACAT
GACTATAATAAGTAAATAATCATGCTTTTATTTCATATATATATAAGGACTATTAAAGAGGTTTAACACCTCCGATACAAATTAAAGATCCATCA
TGG
GACTATAATAAGTAAATAATCATGCTTTTATTTCATATATATATAAGGACTATTAAAGAGGTTTAACACCTCCGATACAAATTAAAGATCCATCA
TGG
Unigenes |
Current Unigene builds | |||||
[SGN-E694978] | SGN-U593339 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T492444 [Download][View] | Facility Assigned ID: LH_Ea05F08.r |
Submitter: Eyal Fridman | Sequencing Facility: AGI |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.885 | Expected Error Rate: 0.0161 | Quality Trim Threshold: 14.5 |