Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E696232

Search information 
Request: 696232Match: SGN-E696232
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469398Clone name: LH_Ea08J14
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469398 [LH_Ea08J14] Trace: SGN-T495483 EST: SGN-E692392 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696232Length: 190 bp (1142 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E696232 [] (trimmed) AGGGTCAGACATGCTTATAGCAGTAATTTTCCCTTCAAGCCAGGAAAAGGCATACACCTTGCTGTTACACTAAAATCAAACAAGCCACATAATCC
AATTCCAATAACAATTTAACAACATAGATAGATGAGCCTTATGCTGAAGCAGCACCTTCTTCCAGCAACTGTTTCACCTTGGTGATGTAGTCGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E696232] SGN-U581521 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491240 [Download][View] Facility Assigned ID: LH_Ea08J14.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0140 Quality Trim Threshold: 14.5