Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E699234

Search information 
Request: 699234Match: SGN-E699234
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C472400Clone name: FA09AH04
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E699234Length: 460 bp (1055 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E699234 [] (trimmed) AATATACTTACTTTTTTCTCTTGGATTGTTACAGTTCTAGCTGAATTTCATGGCGAACGATTTGGAAACATCGCCGGCGGCAGCAGCATCCACCG
TCGTTGATGATACCATTGAGGATGCCTGTAGTATTTGTCTTGAGCCGTTTAACTCCGATGATCCTCCTGCTGTAACACATTGTAAGCATGAATAT
CATTTGCAGTGTATTCTTGAATGGCCTCAAAGAACCAAGGAGCGCCCAATTTGTTGGAGGGTTTTTGCATTGAAAGACTCTGCAAGCCAAAAGCT
ACTAGCTGCAGTGGAGATTGAAAGGAACATGACGCCAAGGATTAATGTGCGTCATACTAACGAAAATGTTGAACCCAATCATGATGCCACCCAGC
AAAATGATTCCAATTTTGAGGACCGAATTATGCGACATTTTGCTGCTGCCACCAGTACAGCCCGGCTTGTCATCAAAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E699234] SGN-U565190 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T510174 [Download][View] Facility Assigned ID: FA09AH04
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0196 Quality Trim Threshold: 20.5