SGN ID: SGN-C472597 | Clone name: FA10AB10 |  | Order Clone |
|
Library Name: FA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E699431 | Length: 257 bp (1238 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E699431 [] (trimmed)
GAAAAAAAATGATGGGTTCCAAGGAATTTCTATTTCTTGGCATTCTTTTGGCTATTTTTGCAATGATAAGCTGTGAGACCTCAATGAAATTGGAT
GACAAGAATGATGAATACCATGATGGATATAATGGCATTGCCGTATATTCTGGTGATGGACGTGGCAAATATAATACTGGATATAACTCTCCCCT
CGATAAATATACCTCCCCTACTGCACAATACCCGCCTCCAGGTGACAAATATAGATCCCCATATGAC
[BLAST] [AA Translate]
SGN-ID: SGN-T509596 [Download][View] |
Facility Assigned ID: FA10AB10
|
Submitter: None |
Sequencing Facility: Kazusa1 |
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 |
Expected Error Rate: 0.0248 |
Quality Trim Threshold: 14.5 |