Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E710573

Search information 
Request: 710573Match: SGN-E710573
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C483739Clone name: FA55DD03
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E710573Length: 622 bp (1244 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E710573 [] (trimmed) GGTTTCTACCCGCAATCCCCAACCCGGCAAACCCCTAATCTTCATCATTTTCTTCAGGATTTGACTCTAATCGTGAACAATCTAGGGCTGGAATA
GAGCGGTTTTCGCAGTAGTAATCATGAATATCTTCAGACTGGCCGGAGACATGACACATTTGATTAGTGTCTTAGTTCTCCTCCTGAAAATCTAT
GCTACCAAATCATGCTCAGGAATATCATTGAAGACGCAAGAGTTATATGCTATTGTGTTTGTGGCTCGGTATCTGGATTTGTTCACAGACTTCAT
CTCTCTTTACAACACTGTGATGAAACTGGTTTTTATTGGGAGCTCCTTGGCCATTGTCTGGTGTATGAGGTACCATCGAGTTGTTAGGCGCTCAT
ATGACCGTGAGCTAGACACTTTTCGCTATTGGATTCTTCTGGGGGCGTGTTTTGTTTTGGCACTTGTTCTTCATGAGAAGTTTACCCTTCAAGAG
GTGTTCTGGGCTTTCTCCATATACCTACAGGCAGTTGCCATTCTTCCCCAATTGGTGCTCTTGCCAAGAACTGGAAATGTTGATAATCTGACTGG
ACAATATGCGTTCTTTCTTGGGGCCTACCGTGCATTTTACATCTTAAACTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E710573] SGN-U603805 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T498457 [Download][View] Facility Assigned ID: FA55DD03
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5