EST details — SGN-E713009

Search information 
Request: 713009Match: SGN-E713009
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C486175Clone name: FB06BH05
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E713009Length: 400 bp (1145 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E713009 [] (trimmed) GATTATGTGAAACTCAGCCCTGGAGAAACTTTATATGAACGCTCTGGTGACCCTCATGCCTATGTAGATGGTGAATCGGTTGAATGCATGGCTGA
TTCAAATAACGTGATACTTGCTGGTCTAGCTCCCAAGCAACTAAATGTTAAGATACTGTGTCTCTCTGCTCACATACAAACAGGGTTTTCCTGAT
ATTCTGAAAGGAACTGCGGTTAATCCTTACACAAAGATATACCTTCCTCCTGTTGATGATTTCGAGGCGGACCGTTGCATTCTTCCACAAAACTC
CACTACTGTATTTGCTTCAATTCCTGGTCCTTCCATTTTTTTTGGCCGCGGAAGGACAGGGAACGATGACCACATCATCTAACAAGGTAGTTGCT
GAAGGTGATGTCTTATTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E713009] SGN-U595357 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T515983 [Download][View] Facility Assigned ID: FB06BH05
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0345 Quality Trim Threshold: 14.5