Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E716451

Search information 
Request: 716451Match: SGN-E716451
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C489617Clone name: FB17AD04
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E716451Length: 508 bp (1186 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E716451 [] (trimmed) AACGCGATATCGCCCTATAGTGACTAGCATTAACAGGTGAGCTTTTGGTGCATCCAAGAGCAACCATCTCAAAGGCCAACGATGGGCAAGGTGGT
TCAGATGTTAGAAGGCGTTTTTGAGATTGATCGGCCACCAGCACCCAAGGCTACTGAAGGGTCCTTTGCTGGTACCAGCTTAAACGCCAGTAGCA
CAAGCGGTCTCTCCACCTTCGCAGCCTCGGCCCCAGCTCCCTCTTCATCATCATCATTCCAAACTGCAGGATTCCAGTCTTCAGCCTCTGCAATG
AATGTCGATAGGCAATCATCATCACTTCTACACTCCGAAATTAAGTGAGTGTAAACCATACTCTTTAGATTCCCTACAAGAACTGATGGGAGTTT
TAGTATCTCAAAGATCATAGTTTGACTTGTCTCTTACAATTCATATTGTATAATAGATAGGGTTTGCATATATATTGATATGTTGTGACTCGATA
ATATTTAGAAAATACTACTCACTTATTTTCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E716451] SGN-U602339 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T512689 [Download][View] Facility Assigned ID: FB17AD04
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0118 Quality Trim Threshold: 12.5