EST details — SGN-E723517

Search information 
Request: 723517Match: SGN-E723517
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C496683Clone name: FC20DA07
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E723517Length: 475 bp (1291 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E723517 [] (trimmed) ATATAGGGCGAATGGCGGCAAATCGGCCGAATTGACCACTTTCTTTCCAAAATTATTGTAATTGAATAAAATATGGGTGTGAAAGGCAAATTAAT
TGCTTTAGTGGAGGTAAAGTGTGGAGGACACCCGATTCTTGATTTTTTTCACATCCATACCCATCATATACCTAATATAAGTCCTAATATTATCA
ACCATTTGGAGATACACGCAGGTGAAGCTGTAAAAGTTGGTTCGATCGTTAGCTGCAATTATAACGAAGCTGGACAAAAGAAGTCTGCTAAGCAA
GTAATTGAAGCCATCGACCTTGAAAAGAAATCTTATCACTTGAAAAGTGATTGAAGGAGATGTGTAAAAGTCGTTTAGGTCCTTTTATGGTATCC
TATCTTGTGAAATCTAGGGGATTAAATAGGATAATATGACTAAAAAATGACAAATGCTGATTTTCAATAGTCTCCATTTTAATTGGGTCTTCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E723517] SGN-U592224 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T519933 [Download][View] Facility Assigned ID: FC20DA07.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0012 Quality Trim Threshold: 20.5