EST details — SGN-E736801

Search information 
Request: 736801Match: SGN-E736801
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C509967Clone name: LC07BA08
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E736801Length: 391 bp (1209 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E736801 [] (trimmed) TTTTCTTCTTCTTCTTCTTGAAGATTTTCTCTTTAAGAAAATATATACAACCATTTATACTTCAGATTCACATTGTTCTCTCGACTATATTGCCC
CCCTTTTCAATTCTTGAACCATAATGCTTCATACACTATAATCAGATTGAAAAAAAAAATTGATCTTTCCCTAAAAGATTGAAACTTTCTTGAGA
TTTTTTGACACCCACTTTGAGTTTCTTCTCAATTTGGACATTTCTTCAGTGTTTCTGCGTGAGTTTGCTGCTTTTGCGAAAAGGGAAGTAAAAAC
ATGTCGGAATCTCAAAGGAGGCCAGCGGTTATTGGGATTTGGGGTGGAAACGGGAACATCATTGGTGAAATACGATTGAGGTCCCCAATTTCTAA
AGCTGAGGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E736801] SGN-U600914 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T540325 [Download][View] Facility Assigned ID: LC07BA08
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0299 Quality Trim Threshold: 14.5