EST details — SGN-E740777

Search information 
Request: 740777Match: SGN-E740777
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C513943Clone name: LC22DC10
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E740777Length: 451 bp (1130 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E740777 [] (trimmed) CTCTTAGCTCACAATTCAACTAGTAGTATATTGAGTTGATCAAATGGCTTCCATGACAATGACAACCTCCTTGGCCGGCGGTTCGATCGCGGCCC
TGACCAAAGCCCCGGCCGCGACCCGTGGTGCTAGGGTTGTTATGGTGAAAGCTAGTTCTCATGTGTCTGAGGGAGAAAATGTTGTAATGAGCAAC
AAGAAGGAGATCAACAACAACAACGGTGGTCGTAGGGAGTTGTTTTTTGCCATGGCGGTCGCTGCCGCATGTTCTGTGGCTGGGGCCGCCATGGC
AGACGATGAGCCGAAGCGCGGCTCACCGGAGGCCAAGAAGAAGTACTTTCAAGTTTGTGTCTCAAATCCTACTGCTAGAATTTGCCGCAATGCAA
CTTAGAAGGGCAAGTGTTTTGTCTATTTAATCATTTCTTGTACTTATTATGCTATGGTTTTAATTAATGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E740777] SGN-U577606 Tomato 200607 Build 2 158 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T536807 [Download][View] Facility Assigned ID: LC22DC10
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5