Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E833285

Search information 
Request: 833285Match: SGN-E833285
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C666333Clone name: CC-F01_012_E07.scf
nocartOrdering Not Available
Library Name: irdccfOrganism: Coffea canephora

Tissue: Cherry of different developmental stages
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E833285Length: 625 bp (685 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E833285 [] (trimmed) gcgtgtatatatatatatatatatatatatgtatataggtagagatttacagaaaccacaaacatggaatctggtatgataaatttgggaagctc
tctaaaagtatcctttgttcaggagttggctaaggagaaatttgcatcagttccaccccgatacatacgacctgatccaaccaaacttgatgggg
cctccacagaggaaatcccagtaattgacatgcaaaggttgctttcggatgaatcagtgaatccagagcttgaaaagttgcattttgcctgcaaa
gaatggggcttcttccagctgattaatcatggagtgagctcttcattagtggacaaactgaaactagagatgcaaaagtttttcaatttgacgat
tgaagagaagaagagatttgcccaagaaccgggcgatgtagaaggatatggacaggcctttgttgtatcggaggaacaaaaacttaactggggtg
acatgctattcatggtcgctctgccaactcacttgagaaaacctcatttacttcccaaccttcctcttccattcagagaaactctagatcagtac
tcaagggaattgaaaatccttgccatcaaggtccttgagcaaatgacaaaagcat
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E833285] SGN-U620248 Coffea canephora Build 3 1 ESTs assembled
[SGN-E833285] SGN-U638505 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T666422 [Download][View] Facility Assigned ID: CC-F01_012_E07
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: