This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U594950 in the current build, Tomato 200607 #2
Unigene SGN-U170685

Unigene Basic Information 
Unigene ID: SGN-U170685
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 170685
mRNA sequence: Length: 173 bp

>SGN-U170685 Lycopersicon Combined #2 (1 members)
ACTAATTTTGCCACCGTGAGATTAAGGATCATTTTTGAAAATGGTATTACGGTTGTGAGCAATCAGGTACAACATTCAATTGTTGACATG
CGTGCTCAACACAAAATGGCTGAGCTTTGTCAGCTTACAGGAGTCGAACTTATTACGTCTGTCTCTCTCTTATAACGATACAT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None