This unigene is from an out-of-date build,
Solanum tuberosum #2
It has been superseded by SGN-U274313 in the current build, Solanum tuberosum #4
It has been superseded by SGN-U274313 in the current build, Solanum tuberosum #4
| Unigene Basic Information |
| Unigene ID: | SGN-U191210 |
| Unigene Build: | Solanum tuberosum #2 |
| Date: | 2003-12-04 |
| Organism: | S.tuberosum |
| Alternative ID: | 191210 |
| mRNA sequence: | Length: 245 bp |
>SGN-U191210 Solanum tuberosum #2 (1 members)
CGGGCCCCCCCTCGAGTTNTTAAAAACCAAAAAGGGGTTTTTTTTTTTTTTTACAACGAAAAAGAAATCCTTTTGAATTATCTAATATAT
AATAAAAAAAAACCTCTATTACTCCAAATAACAGTATTTTGTCAAAAGGAAAGAAATAAAGATATGAAGAAAATTACAACCGATTAATAC
GACAAAATTTAAATTTAAACTAGACTAATATAAAATATAAAATGAACCAACGAGGAAGGATATTG
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 0 | go: 0 )
|
Protein prediction analysis (0)
|
| Gene Family (0) |
| Preceding Unigenes (0) |
Library representation (1)
Library representation (1)

