Notice: the solgenomics has been unstable, we apologize for the inconvenience.

Unigene SGN-U206783

Unigene Basic Information 
Unigene ID: SGN-U206783
Unigene Build: Solanum melongena #2
Date: 2004-01-12
Organism: S.melongena
Alternative ID: 206783
mRNA sequence: Length: 178 bp

>SGN-U206783 Solanum melongena #2 (1 members)
TTGTTTACACCTAGCAAATTCTTTCCTGTCCCCGGGAAATAAGAAAAGGTGATGATAAATGGCAAAGGGTCGGAAACTGACCACTAGTCG
TAGCGATATGTTATTAGGAAACTACCCCAGCTATAGAAATGGAAGTGTAACAATCAACGGTTCCTCAGAACTAGGAGAAGATGATGTC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None