This unigene is from an out-of-date build,
Coffea canephora #1
It has been superseded by SGN-U627463 in the current build, Coffea canephora #3
It has been superseded by SGN-U627463 in the current build, Coffea canephora #3
| Unigene Basic Information |
| Unigene ID: | SGN-U311022 |
| Unigene Build: | Coffea canephora #1 |
| Date: | 2005-04-24 |
| Organism: | C.canephora |
| Alternative ID: | 128261 |
| mRNA sequence: | Length: 154 bp |
>SGN-U311022 Coffea canephora #1 (1 members)
GCTGAATTGCAAATCCCTGTAACCTTGCAACTGCTATACTTTTGTGCTATGTACAGAGCAAGAGATCCCCAACCACAACCAACATCAAGA
ACAGTATGGCCATCTTTTATTTGTGACCTTTCACAGTATAGCTCCAGCATTGCTTTCTCTGCAT
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 1 | go: 1 )
|
Protein prediction analysis (1)
|
Gene Family (3)
|
| Preceding Unigenes (0) |
Library representation (1)
Library representation (1)

