Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U585549 in the current build, Tomato 200607 #2

Unigene SGN-U317524

Unigene Basic Information

Unigene ID:	SGN-U317524
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	317524
mRNA sequence:	Length: 2107 bp

>SGN-U317524 Tomato 200607 #1 (21 members)
CTCGTGCCGTCACCGCTACCTCAATCGACTAAATTCTCAATTTTAAGTTGGTTTTGTAACTTAGTTGTTCTTTTTAATTTGTCGAAATGA
CTTCTTTTTCTGTTAAATTTTCAGCTACTTCACTTCCAAATTCTAATAGATTTTCCAAACTTCATGCTACTCCACCGCAGACGGTGGCGG
TACCGTCGTACGGGGCGGCGGAGATAGCTGCTGAAAGACTAGAGCCTAGAGTTGAGCAAAGAGATGGGTATTGGGTAGTTAAGGATAAGT
TCAGACAAGGCATAAATCCAGCTGAAAAGGCGAAGATTGAAAAGGAACCAATGAAACTATTCACTGAAAATGGTATCGAAGATCTTGCTA
AGATCTCGCTTGAAGAGATCGAGAAATCAAAGCTAACTAAAGAAGATATTGATATTCGCCTCAAGTGGCTTGGACTCTTCCATCGGAGAA
AACACCACTATGGTCGATTCATGATGCGATTGAAGCTTCCAAATGGAGTAACGACGAGTGATCAAACTCGATATTTAGGTAGTGTGATTA
GGAAATATGGGAAAGATGGATGTGGTGATGTGACTACAAGGCAAAATTGGCAGATTCGTGGGGTTGTGTTACCTGATGTGCCTGAGATTC
TAAAGGGGCTTGATGAAGTTGGCTTGACTAGTCTGCAGAGTGGCATGGATAATGTTCGAAATCCGGTGGGGAATCCTCTCGCAGGGATTG
ATCTTCATGAAATTGTAGACACAAGGCCTTACACTAATTTGCTGTCCCAATATGTCACCGCCAATTTTCGTGGCAATGTGGATGTGACTA
ACTTGCCAAGGAAGTGGAATGTATGTGTAATAGGGTCACATGATCTTTATGAGCATCCGCATATCAATGATCTTGCGTATATGCCTGCAA
CCAAAGATGGACGATTTGGATTCAACCTGCTTGTGGGTGGATTCTTCAGTCCGAAGCGATGTGCAGAGGCAATTCCTCTTGATGCATGGG
TTCCAGCTGATGATGTAGTCCCTGTTTGCAAAGCTATATTAGAAGCTTATAGAGATCTTGGTACCCGAGGGAACAGGCAGAAAACAAGAA
TGATGTGGTTAATTGACGAACTGGGTGTTGAAGGATTCAGGGCAGAAGTTGTGAAGAGAATGCCCCAAAAGAAGCTAGATAGAGAATCTT
CAGAGGATTTGGTCCTGAAACAATGGGAAAGGAGAGAGTACCTTGGCGTGCATCCGCAGAAACAGGAAGGATACAGCTTTGTTGGTCTTC
ACATTCCGGTTGGTCGTGTCCAAGCAGATGACATGGACGAGCTAGCTCGTTTGGCTGATGAGTATGGTTCAGGAGAACTCCGGTTGACTG
TTGAACAGAACATCATTATTCCCAACATCGAGAACTCAAAGATCGATGCATTACTCAATGAGCCTCTCCTAAAGAACAGATTTTCACCTG
ATCCACCTATTCTCATGAGAAATTTGGTGGCTTGTACTGGTAACCAATTCTGTGGGCAAGCAATAATCGAGACTAAAGCACGTTCAATGA
AGATAACCGAGGAGGTTCAACGTCTAGTCTCTGTGACACAGCCAGTGAGGATGCACTGGACAGGTTGCCCAAATACATGTGGACAAGTTC
AAGTTGCCGATATCGGATTCATGGGATGCCTGACTAGAAAGGAAGGCAAAACTGTTGAAGGTGCTGATGTTTTCTTGGGTGGCAGAATAG
GGAGCGACTCGCATTTAGGAGAAGTTTATAAGAAGTCTGTACCATGTGAGGATTTGGTACCAATAATCGTCGACTTACTAATTAACAACT
TTGGTGCTGTTCCAAGAGAAAGAGAAGAAACAGAGGAGTAATCTAAAATCTTCAGAATGTACTTTTTATGATATTGAAATATTTCCAAGG
TACAGCATTGTAAGTTAGTAAAATAATCACAACATGAGATGTTGTTAACATGTTCATGTGTGACATAGCATGATGCAAATACTTGAACTT
GTTTCAAAATATAATCACATTGTGTATTCTTTTGGAAATACTCATCCAAACTAAAAGGCTTTTGAATTGTTGAATTCCTAATAATACATT
TTTTAAAAAGTAATTTGATATACAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
nii2	nitrite reductase 2	nitrite reductase

Genomic locations (0)

None

Library representation (9)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	4
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	5
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	4
Solanum lycopersicum	vSlycmRNA		8362	2

mRNA member sequences (21)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102206	Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128)	19
2	120151	Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like	10
5	130665	Nitrite and sulfite reductase iron-sulfur/siroheme-binding site - Biological Process: electron transport (GO:0006118) Nitrite and sulphite reductase 4Fe-4S region - Biological Process: electron transport (GO:0006118) Ferredoxin-nitrite reductase - Molecular Function: oxidoreductase activity acting on other nitrogenous compounds as donors iron-sulfur protein as acceptor (GO:0016664) - Biological Process: nitrate assimilation (GO:0042128) Nitrite/sulfite reductase flavoprotein alpha-component domains 1 and 3 Nitrite/sulfite reductase hemoprotein beta-component ferrodoxin-like	9

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (2)

Unigene	Build
SGN-U218320	Lycopersicon Combined #3
SGN-U221852	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: