This unigene is from an out-of-date build, Coffea canephora #2
It has been superseded by SGN-U616867 in the current build, Coffea canephora #3
Unigene SGN-U358549

Unigene Basic Information 
Unigene ID: SGN-U358549
Unigene Build: Coffea canephora #2
Date: 2007-05-18
Organism: C.canephora
Alternative ID: 358549
mRNA sequence: Length: 61 bp

>SGN-U358549 Coffea canephora #2 (1 members)
CCTCAGCCACGAAACAATAAACTCTGCTCCACTCAACTCTTTCCTCTGTGTCTTGTACTCT

[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)