Unigene SGN-U627239

Unigene Basic Information 
Unigene ID: SGN-U627239
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 68 bp

>SGN-U627239 Coffea canephora #3 (1 members)
CTTGCTTTGGAGGCTGAAGTTTTGAAAAATCCTGATCATGCTGAGGGTTGGAGGTTGCTGGGCTTTGC

[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)