Sol Genomics Network

Unigene SGN-U197512

Unigene Basic Information

Unigene ID:	SGN-U197512
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	197512
mRNA sequence:	Length: 687 bp

>SGN-U197512 Capsicum annuum #1 (3 members)
CTTCAGAGAGCATTCCTCCACAAGAAAGCAGAAGCGGTAAAACAGGAAGAGATGAGTGCTTACAATGCTTTTAAAGCTTGTGCTCCAGTC
GCATGGAGCCCTAATCTATACATAACCCTTGTAAGGGGTATTCCGGGTACAAGGAGGCTCCATAGGCGTACCCTTGAGGCATTACGCCTT
GGCAAATGCAACCGGACTGTAATGAGATGGAACACACCCACTGTTAGGGGAATGCTTCAGCAGGTGAAAAGATTGGTTGTCGTTGAGACA
GAAGAGATGTACAAGGCACGTATGGAGAAAATAGCTAATCACAAAGCTCTACGCCCTCCTTTGGTTATAAACCATCACGCAGCCCCTGCA
GCTGATTCAGTTCAGTAACTGTCGAAACTCTTTCCTGGTCAGTTTTGTAATTTTGTCCTGCTAATGTTCCGACAATGTAGTGCACCCAAG
TAATGTTTTGGAACATTTTGAAGCATATGCTATGAAATTGCATCGAACCTTTGTATTCAGGTGGTGGTTATTATTGTTTCGGCTATAGTA
GAAAACACTATGCCTCTGGAGCAATCTAGAGAGCTGATTAAGTCGTTACTGTGTAATAAGTGAAGAAAGATGATATAAGCACGTAAACTA
AAAACTGGTTCTAGCCTGTTGATACGAGGTTTTCAGGATTCAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS07	Flower bud	4235	3

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	3256	Ribosomal_L30 Ribosomal_L30b/o	5
2	26955	Ribosomal_L30 Ribosomal_L30b/o	4
5	60995	Ribosomal_L30 Ribosomal_L30b/o	4
1.1	104591	Ribosomal protein L30 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L30 bacterial - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: large ribosomal subunit (GO:0015934)	4
2	123910	Ribosomal protein L30 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L30 bacterial - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: large ribosomal subunit (GO:0015934)	4
5	134071	Ribosomal protein L30 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L30 bacterial - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: large ribosomal subunit (GO:0015934)	4

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: