Sol Genomics Network

Unigene SGN-U199564

Unigene Basic Information

Unigene ID:	SGN-U199564
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	199564
mRNA sequence:	Length: 672 bp

>SGN-U199564 Capsicum annuum #1 (1 members)
CCCTGCTGTATACAAAGATCCAAACTTTGTATCTTGCTCAACTTGCAAATCATAAACCGACACGTGCGTCGGTTTTGCTTGAATAGTGAG
GCTCAAACTTTCTTCCCACATATGTGATTTCTGATGCGGAAGCGAAGATATAAGATCCACACTCCAATTCTCAACACCACATGATCCAAC
AATATCAATAGCCTCATGAATTTCCCGTACACCGTGCGCTCTCCCACAACTCTTTAGCAACTCCTCCTGAAACGCCTGAACTCCTAAAGA
CACCCTATTGACACCCAAATTCATCAAATCTTTCAATTTTTCAACATCAAATGTACCAGGATCCATTTCTATCGAAATTTCAGCATCCGT
ACACACCCCAAATTTAGCGTCCAACGTCTCCAGGACTAGAGATACTAATCTTGGTGGCACAAGTGAAGGTGTACCTCCGCCAAAAAAGAC
GGTTTCCATAGGTGACTTGTTGTAGTTTGAAGGTACTGAAGTGGCTTTAATTTCTCTACATAGGTAGTCAATGTAGTTAACAATTCGGGG
GTCGTCTTCGTCTTCGTCTTCATCTCCGTGAGGTGAAGATAACCCGAGAGCGACGATTGGGAAGTCACAGTAGTGACAACGCTTTCGACA
GAACGGGAGGTGAACGTAAGCTGAAGTTGGGTTATGCTGCTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS07	Flower bud	4235	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E496961
[Show Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	3828	HemN_rel HemN Radical_SAM	4
2	28181	HemN_rel HemN Radical_SAM	3
5	64470	HemN_rel HemN Radical_SAM	2
1.1	104077	Elongator protein 3/MiaB/NifB Putative oxygen-independent coproporphyrinogen III oxidase - Molecular Function: coproporphyrinogen oxidase activity (GO:0004109) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: porphyrin biosynthesis (GO:0006779) HemN C-terminal - Molecular Function: coproporphyrinogen oxidase activity (GO:0004109) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: porphyrin biosynthesis (GO:0006779) Radical SAM - Molecular Function: catalytic activity (GO:0003824) - Molecular Function: iron ion binding (GO:0005506)	5
2	123932	Radical SAM - Molecular Function: catalytic activity (GO:0003824) - Molecular Function: iron ion binding (GO:0005506) Putative oxygen-independent coproporphyrinogen III oxidase - Molecular Function: coproporphyrinogen oxidase activity (GO:0004109) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: porphyrin biosynthesis (GO:0006779) Elongator protein 3/MiaB/NifB HemN C-terminal - Molecular Function: coproporphyrinogen oxidase activity (GO:0004109) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: porphyrin biosynthesis (GO:0006779)	4
5	134095	Radical SAM - Molecular Function: catalytic activity (GO:0003824) - Molecular Function: iron ion binding (GO:0005506) Putative oxygen-independent coproporphyrinogen III oxidase - Molecular Function: coproporphyrinogen oxidase activity (GO:0004109) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: porphyrin biosynthesis (GO:0006779) Elongator protein 3/MiaB/NifB HemN C-terminal - Molecular Function: coproporphyrinogen oxidase activity (GO:0004109) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: porphyrin biosynthesis (GO:0006779)	4

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: