Sol Genomics Network

Unigene SGN-U202556

Unigene Basic Information

Unigene ID:	SGN-U202556
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	202556
mRNA sequence:	Length: 680 bp

>SGN-U202556 Capsicum annuum #1 (1 members)
CGGCCGCTAAATTATCTTACTGTATATCAACAAAATTTCTCTTACAATCAATTCAACAATTTCGTAATGATCTCTGCCTAAATATTTGGC
TCTCCCCTTTTCAATCCATCTTTTGGAGTATGAGGAGGTAAGCTAGAAATCGGAACCATTGGCACATAACATTAGATCCTCCCTATTTGG
TAAAAATGATCGATCTCACAAGCGACCGTCAGAGAGGGATATTTAGAGTACATAACTGTATTTACAGGATTACATCATCAGCTATACAAA
ATGGTATCCATCATCCTACAGCTGCTCATGCTGCAAATAACCTGCATGCAGGAATAACTATGCTTCTACCGCTGCATCTTCAACTTCATG
ATCTGAATCTGCATCTGCTGCTGTGATCAATGAAGCTGACTGAATCTTCCCAGCATGCTCAAGACGCATCAGAATTACTCCTCTCGCATA
CCGAGACTGTATAGAAATGTCCCGAACTTTTATGCGATTCACAGTTCCACTCTGGCTCACGAGAACAACTTGCTCGTCACTCTCACCATC
CTCTCCAAAGGAGAAGCCTACAACGAATACTGCTGCCAGGCGATCTTCAGATGAAAACTTGTAACCAATTAAACCGACTCTATTTAAAGG
TGATGTACGGAATCTGCTAACTGGAACTCGCTTCCCATAACCACTTTCCG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS08	Anther	2304	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E500858
[Show Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2467	UPF0052 DNA_gyraseA_C TopoIV_A_Gneg TopoIV_A_Gpos DNA_topoisoIV DNA_gyrA RPEL_repeat	7
2	24871	UPF0052 DNA_gyraseA_C TopoIV_A_Gneg TopoIV_A_Gpos DNA_topoisoIV DNA_gyrA RPEL_repeat	7
5	58917	UPF0052 DNA_gyraseA_C TopoIV_A_Gneg TopoIV_A_Gpos DNA_topoisoIV DNA_gyrA RPEL_repeat	7
1.1	101724	DNA topoisomerase type IIA subunit B or N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	43
2	122433	DNA topoisomerase type IIA subunit B or N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA central - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265) DNA topoisomerase type IIA subunit A or C-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265) WD40-like DNA gyrase/topoisomerase IV subunit A C-terminal beta-pinwheel - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase activity (GO:0003916) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA subunit A or C-terminal alpha-beta - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265) DNA gyrase subunit A - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	5
5	132621	DNA topoisomerase type IIA subunit B or N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA central - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265) DNA topoisomerase type IIA subunit A or C-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265) WD40-like DNA gyrase/topoisomerase IV subunit A C-terminal beta-pinwheel - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase activity (GO:0003916) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase type IIA subunit A or C-terminal alpha-beta - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA metabolism (GO:0006259) - Biological Process: DNA topological change (GO:0006265) DNA gyrase subunit A - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: